Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07693
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290174
Product ID ORK07693
Clone name ph00435y1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIF5A
cDNA sequence DNA sequence (5825 bp)
Predicted protein sequence (1056 aa)
Description Homo sapiens mRNA for KIF5A variant protein
Features of the cloned cDNA sequence

Length: 5825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2452 bp
Genome contig ID gi89161190f_56130048
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAACTTTAAAATAAAATAAATTCAATGATAACTCT
Flanking genome sequence
(136636 - 136685)
----+----*----+----*----+----*----+----*----+----*
ATGTTGTTGTAAATATTCTTTATCCCTTCCCAATCTCACTGCCTTCTTTG

Features of the protein sequence

Length: 1056 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06127 0 100.0 KIF5A variant p...
Homo sapiens
BAG06728 0 100.0 KIF5A variant p...
Homo sapiens
Q12840 0 99.9 Kinesin heavy c...
Homo sapiens
BAG37640 0 99.8 unnamed protein...
Homo sapiens
AAA20231 0 99.8 neuronal kinesi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001752 101 122 PR00380 Kinesin
IPR001752 220 237 PR00380 Kinesin
IPR001752 251 269 PR00380 Kinesin
IPR001752 301 322 PR00380 Kinesin
HMMPfam IPR001752 39 352 PF00225 Kinesin
HMMSmart IPR001752 31 359 SM00129 Kinesin
ProfileScan IPR001752 30 281 PS50067 Kinesin
ScanRegExp IPR001752 250 261 PS00411 Kinesin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp