ORK11840

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11840

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11840
Clone name	pj01045
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone pj01045 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCKKGGGGRAGAW) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	PTK2B
cDNA sequence	DNA sequence (4094 bp) Predicted protein sequence (1014 aa)
Description	Protein tyrosine kinase 2 beta (EC 2.7.10.2)(Focal adhesion kinase 2)(FADK 2)(Proline-rich tyrosine kinase 2)(Cell adhesion kinase beta)(CAK beta)(Calcium-dependent tyrosine kinase)(CADTK)(Related adhesion focal tyrosine kinase)(RAFTK)

Features of the cloned cDNA sequence

Description

Length: 4094 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	877 bp
Genome contig ID	gi51511724f_27138966
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTGACTTGTGGTTGAATTAAAATTGTCCCATTTGC
Flanking genome sequence (233856 - 233905)	----+--------+--------+--------+--------+----* TTTGCGGTTTGTTTTGTTTGTTTGACCTGCCCTTTGGGGGATAATGGGGA

Features of the protein sequence

Description

Length: 1014 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14289	100.0	Protein-tyrosin...	Homo sapiens
AAH36651	99.9	PTK2B protein t...	Homo sapiens
AAC05330	99.8	cell adhesion k...	Homo sapiens
AAX43166	99.8	PTK2B protein t...	synthetic construct
AAB47217	99.8	focal adhesion ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	459	687	PD000001	Protein kinase
FPrintScan	IPR001245	507	520	PR00109	Tyrosine protein kinase
	IPR001245	544	562	PR00109	Tyrosine protein kinase
	IPR001245	592	602	PR00109	Tyrosine protein kinase
	IPR001245	611	633	PR00109	Tyrosine protein kinase
	IPR001245	655	677	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	430	684	PF07714	Tyrosine protein kinase
HMMPfam	IPR005189	875	1013	PF03623	Focal adhesion targeting region
HMMSmart	IPR000299	40	270	SM00295	Band 4.1
	IPR001245	430	684	SM00219	Tyrosine protein kinase
	IPR002290	430	689	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000299	44	364	PS50057	Band 4.1
ProfileScan	IPR000719	430	688	PS50011	Protein kinase
ScanRegExp	IPR000719	436	462	PS00107	Protein kinase
ScanRegExp	IPR008266	550	562	PS00109	Tyrosine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp