ORK06255

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06255

Order Kazusa clone(s) from :

Accession No	AB209623
Product ID	ORK06255
Clone name	sh01672
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	P2RX5
cDNA sequence	DNA sequence (5903 bp) Predicted protein sequence (469 aa)
Description	P2X purinoceptor 5 (ATP receptor) (P2X5) (Purinergic receptor).

Features of the cloned cDNA sequence

Description

Length: 5903 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4416 bp
Genome contig ID	gi51511734r_3413106
PolyA signal sequence (None)	+--------+--------+----*----+---- TAACTTTTGTATTTTTTTAATCACAAGTTTGATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTTTTTATCGTACTCTTTGGAGATGCCCATTCTACTTTTGAATTT

Features of the protein sequence

Description

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92860	1.1e-200	100.0	purinergic rece...	Homo sapiens
EAW90488	5.2e-186	100.0	purinergic rece...	Homo sapiens
EAW90484	4.5e-157	99.4	purinergic rece...	Homo sapiens
XP_001158503	2.3e-129	98.4	similar to P2X ...	Pan troglodytes
AAH39015	7.6e-127	100.0	Purinergic rece...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003048	156	165	PR01312	P2X5 purinoceptor
	IPR001429	198	209	PR01307	P2X purinoreceptor
	IPR001429	282	294	PR01307	P2X purinoreceptor
	IPR001429	328	338	PR01307	P2X purinoreceptor
	IPR001429	348	362	PR01307	P2X purinoreceptor
	IPR003048	376	384	PR01312	P2X5 purinoceptor
HMMPfam	IPR001429	106	401	PF00864	P2X purinoreceptor
HMMTigr	IPR001429	133	388	TIGR00863	P2X purinoreceptor
ScanRegExp	IPR001429	289	315	PS01212	P2X purinoreceptor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp