ORK04125

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04125

Order Kazusa clone(s) from :

Accession No	AK226157
Product ID	ORK04125
Clone name	sj05248
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	APIP
cDNA sequence	DNA sequence (4565 bp) Predicted protein sequence (199 aa)
Description	APAF1-interacting protein.

Features of the cloned cDNA sequence

Description

Length: 4565 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3805 bp
Genome contig ID	gi51511727r_34731329
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTTGAGGCCAGGAGTTTGAGATCAGCCTGTCTC
Flanking genome sequence (99905 - 99856)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATCTCTGAACAATATTTTAAAAACATCATCACGT

Features of the protein sequence

Description

Length: 199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001149696	3.5e-89	100.0	hypothetical pr...	Pan troglodytes
AAH10133	2.1e-86	100.0	Unknown (protei...	Homo sapiens
Q96GX9	5.6e-86	100.0	APAF1-interacti...	Homo sapiens
BAG63579	5.9e-86	100.0	unnamed protein...	Homo sapiens
AAH08440	1.5e-85	99.4	APAF1 interacti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001303	1	196	PF00596	Class II aldolase/adducin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp