ORK04728

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04728

Order Kazusa clone(s) from :

Accession No	AB209595
Product ID	ORK04728
Clone name	sj06224
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDX17
cDNA sequence	DNA sequence (4717 bp) Predicted protein sequence (737 aa)
Description	Probable ATP-dependent RNA helicase DDX17 (EC 3.6.1.-) (DEAD box protein 17) (RNA-dependent helicase p72) (DEAD box protein p72).

Features of the cloned cDNA sequence

Description

Length: 4717 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2450 bp
Genome contig ID	gi89161203r_37109391
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTTGTAGGTATAAATAAAAACACTGTTGACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGTGTGAGCTTTTATTGCTTAATTCTCTGAATAATTCAACGTAGACGT

Features of the protein sequence

Description

Length: 737 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92832	100.0	DEAD box polype...	Homo sapiens
XP_525595	99.7	DEAD box polype...	Pan troglodytes
NP_001091974	99.5	probable ATP-de...	Homo sapiens
XP_001092491	99.2	similar to DEAD...	Macaca mulatta
AAH00595	99.2	DEAD (Asp-Glu-A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	197	368	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	439	515	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	192	395	SM00487	DEAD-like helicases
HMMSmart	IPR001650	434	515	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	173	201	PS51195	RNA helicase
	IPR014021	204	379	PS51192	Helicase
	IPR001650	407	554	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	325	333	PS00039	RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp