Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00044
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00044
Clone name pg00681
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CEP170B
cDNA sequence DNA sequence (6430 bp)
Predicted protein sequence (1546 aa)
Flexi ORF Clone FXC00044
Description K0284_HUMAN Isoform 3 of Q9Y4F5 - Homo sapiens (Human)
Features of the cloned cDNA sequence

Length: 6430 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1789 bp
Genome contig ID gi51511730f_104313662
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ATTTGTTCTAATAAATCATTCTTCTATCACATGGC
Flanking genome sequence
(120468 - 120517)
----+----*----+----*----+----*----+----*----+----*
AGCACGCTGGAGCCTGTCACCTTGGCCTTGTTTCTCTATCCTTGGTGTTT

Features of the protein sequence

Length: 1546 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001085858 0 95.0 similar to KARP...
Macaca mulatta
XP_001085960 0 94.9 similar to KARP...
Macaca mulatta
NP_001106197 0 97.6 hypothetical pr...
Homo sapiens
NP_055820 0 97.6 hypothetical pr...
Homo sapiens
XP_854808 0 78.3 similar to KARP...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000253 1 47 PF00498 Forkhead-associated
ProfileScan IPR000253 1 30 PS50006 Forkhead-associated
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp