ORK00055

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00055

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00055
Clone name	ah04440
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ah04440 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	SETD1A
cDNA sequence	DNA sequence (5919 bp) Predicted protein sequence (1709 aa)
HaloTag ORF Clone	FHC00055
Flexi ORF Clone	FXC00055
Description	Histone-lysine N-methyltransferase, H3 lysine-4 specific SET1 (EC 2.1.1.43) (Set1/Ash2 histone methyltransferase complex subunit SET1) (SET domain-containing protein 1A).

Features of the cloned cDNA sequence

Description

Length: 5919 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	637 bp
Genome contig ID	gi51511732f_30777538
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- CACATTTTTATAATTGTGATTAAACTTTATTGTAC
Flanking genome sequence (125946 - 125995)	----+--------+--------+--------+--------+----* AAAAGTGTTTGGTCGGTGTATTTGGGCAGGAGCGAGGGGTTGGGGGTAGA

Features of the protein sequence

Description

Length: 1709 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15047	100.0	Histone-lysine ...	Homo sapiens
XP_523492	99.5	SET domain cont...	Pan troglodytes
XP_001915080	93.4	SET domain cont...	Equus caballus
XP_001251265	92.5	similar to SET ...	Bos taurus
XP_001364653	79.5	similar to SET ...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	112	169	PF00076	RNA recognition motif
HMMPfam	IPR001214	1564	1693	PF00856	SET
HMMSmart	IPR000504	97	170	SM00360	RNA recognition motif
	IPR001214	1570	1693	SM00317	SET
	IPR003616	1693	1709	SM00508	Post-SET zinc-binding region
ProfileScan	IPR000504	86	174	PS50102	RNA recognition motif
	IPR001214	1569	1691	PS50280	SET
	IPR003616	1693	1709	PS50868	Post-SET zinc-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp