ORK00056

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00056

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00056
Clone name	pg01166s1
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT AC AAAAAAGCAG GCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCC CTTTTTTTTT TTTTTT-3' end of cDNA).
Symbol	SYNJ2
cDNA sequence	DNA sequence (6753 bp) Predicted protein sequence (1525 aa)
HaloTag ORF Clone	FHC00056
Flexi ORF Clone	FXC00056
Description	synaptojanin 2

Features of the cloned cDNA sequence

Description

Length: 6753 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2173 bp
Genome contig ID	gi89161210f_158222893
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTAGTAGGTATGGTTCTCATACCAGAATTCTCTT
Flanking genome sequence (216665 - 216714)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGACAATTGGAATTGCCTTATTTATTTTTAAAATCA

Features of the protein sequence

Description

Length: 1525 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15056	100.0	Synaptojanin-2;...	Homo sapiens
AAN73051	100.0	synaptojanin 2A...	Homo sapiens
XP_001381377	80.8	similar to syna...	Monodelphis dom...
XP_001492268	85.8	synaptojanin 2 ...	Equus caballus
NP_001106824	83.7	synaptojanin-2 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	89	378	PF02383	Synaptojanin
	IPR005135	561	891	PF03372	Endonuclease/exonuclease/phosphatase
	IPR015047	892	1037	PF08952	Domain of unknown function DUF1866
HMMSmart	IPR000300	557	899	SM00128	Inositol polyphosphate related phosphatase
ProfileScan	IPR002013	149	473	PS50275	Synaptojanin
ProfileScan	IPR000504	918	997	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	649	RYILLTSAQLVGVCLYIFVRPYH	671	PRIMARY	23