ORK00082

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00082

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00082
Clone name	fg03852
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NOS1AP
cDNA sequence	DNA sequence (6739 bp) Predicted protein sequence (404 aa)
Flexi ORF Clone	FXC00082
Description	Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase protein (C--terminal PDZ ligand of neuronal nitric oxide synthase protein) (Nitric oxide synthase 1 adaptor protein).

Features of the cloned cDNA sequence

Description

Length: 6739 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5290 bp
Genome contig ID	gi89161185f_160206118
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCTCCACTGGGCAGTGGTGGTCAGTTTTTACTGC
Flanking genome sequence (398736 - 398785)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAAAGAGAAAGAAAAAAAAGAATGAATGCAAGCT

Features of the protein sequence

Description

Length: 404 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001115782	9.4e-121	97.9	similar to nitr...	Macaca mulatta
BAG10340	3.4e-101	100.0	carboxyl-termin...	synthetic construct
BAB31095	1.9e-95	94.7	unnamed protein...	Mus musculus
O75052	3.7e-95	98.1	Carboxyl-termin...	Homo sapiens
NP_001103455	5.5e-92	95.8	carboxyl-termin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006020	112	250	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR006020	107	253	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR006020	109	245	PS01179	Phosphotyrosine interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp