Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00101
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00101
Clone name bg00015s1
Vector information
The cDNA fragment was inserted in the XhoI-SacI site of the ...
Symbol ZCCHC14
cDNA sequence DNA sequence (7172 bp)
Predicted protein sequence (1045 aa)
Flexi ORF Clone FXC00101
Description zinc finger, CCHC domain containing 14
Features of the cloned cDNA sequence

Length: 7172 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4034 bp
Genome contig ID gi51511732r_85897378
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTAATGTACTGAAAATAAAAATTTTAAAAAAGAAC
Flanking genome sequence
(99977 - 99928)
----+----*----+----*----+----*----+----*----+----*
TGTTTTATTTCACTAGGTCTTTGTCTCAGAATATGAAGCACACACCTTTT

Features of the protein sequence

Length: 1045 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001092159 0 99.3 similar to zinc...
Macaca mulatta
Q8WYQ9 0 100.0 Zinc finger CCH...
Homo sapiens
AAI01479 0 99.8 Zinc finger, CC...
Homo sapiens
BAF82371 0 99.8 unnamed protein...
Homo sapiens
XP_344781 0 85.7 similar to BDG-...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001878 1002 1011 PR00939 Zinc finger
IPR001878 1011 1019 PR00939 Zinc finger
HMMPfam IPR001660 390 451 PF00536 Sterile alpha motif SAM
IPR001878 1002 1019 PF00098 Zinc finger
HMMSmart IPR001878 1003 1019 SM00343 Zinc finger
ProfileScan IPR001878 1004 1019 PS50158 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp