Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00119
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00119
Clone name pj01912
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DDHD2
cDNA sequence DNA sequence (4481 bp)
Predicted protein sequence (759 aa)
Flexi ORF Clone FXC00119
Description DDHD domain containing 2
Features of the cloned cDNA sequence

Length: 4481 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2201 bp
Genome contig ID gi51511724f_38108850
PolyA signal sequence
(AGTAAA,-29)
+----*----+----*----+----*----+----
AACTTTAGTAAATACTAACATGAAACCATAAAAAC
Flanking genome sequence
(130601 - 130650)
----+----*----+----*----+----*----+----*----+----*
TAGTGGCCTACTTTTACCTGGACTCACCCGTCTCAAAGTCAAGAAAATCA

Features of the protein sequence

Length: 759 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10373 0 100.0 DDHD domain-con...
synthetic construct
O94830 0 99.8 Phospholipase D...
Homo sapiens
BAG51738 0 99.4 unnamed protein...
Homo sapiens
XP_532805 0 94.0 similar to DDHD...
Canis lupus fam...
NP_001069066 0 92.4 DDHD domain con...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004170 83 160 PF02825 WWE
IPR001660 431 493 PF00536 Sterile alpha motif SAM
IPR004177 543 748 PF02862 DDHD
HMMSmart IPR001660 430 495 SM00454 Sterile alpha motif SAM
ProfileScan IPR004170 78 160 PS50918 WWE
IPR004177 543 748 PS51043 DDHD
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp