ORK00139

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00139

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00139
Clone name	ff06519
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MPRIP
cDNA sequence	DNA sequence (3865 bp) Predicted protein sequence (1065 aa)
HaloTag ORF Clone	FHC00139
Flexi ORF Clone	FXC00139
Description	Myosin phosphatase Rho-interacting protein (Rho-interacting protein 3) (M-RIP) (RIP3) (p116Rip).

Features of the cloned cDNA sequence

Description

Length: 3865 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	667 bp
Genome contig ID	gi89161205r_44493798
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTTGTTTGTTTTTTATTAAATCTTGCACAAAAC
Flanking genome sequence (203728 - 203679)	----+--------+--------+--------+--------+----* GAGGAGCTCCTAGCGGTGGTTCCTGAGGAATTGACTAATGAGTTGTTGGA

Features of the protein sequence

Description

Length: 1065 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10393	100.0	myosin phosphat...	synthetic construct
XP_001160793	99.7	myosin phosphat...	Pan troglodytes
BAC78198	99.7	Rho-interacting...	Homo sapiens
BAD89507	99.5	Rho interacting...	Homo sapiens
NP_958431	99.5	myosin phosphat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	71	172	PF00169	Pleckstrin-like
HMMPfam	IPR001849	415	510	PF00169	Pleckstrin-like
HMMSmart	IPR001849	71	179	SM00233	Pleckstrin-like
HMMSmart	IPR001849	415	512	SM00233	Pleckstrin-like
ProfileScan	IPR001849	70	177	PS50003	Pleckstrin-like
ProfileScan	IPR001849	414	510	PS50003	Pleckstrin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp