Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00153
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00153
Clone name af12619
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NAV3
cDNA sequence DNA sequence (8261 bp)
Predicted protein sequence (1850 aa)
Flexi ORF Clone FXC00153
Description Neuron navigator 3 (Steerin-3) (Pore membrane and/or filament- interacting-like protein 1) (Unc-53 homolog 3) (unc53H3).
Features of the cloned cDNA sequence

Length: 8261 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2494 bp
Genome contig ID gi89161190f_76854537
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
ATTACTTTGCCATTAAAGTGGAATTATTTATTGAC
Flanking genome sequence
(276384 - 276433)
----+----*----+----*----+----*----+----*----+----*
AACATGGTGTGGTTTCTATTTATGGAAAAAAATGAATAATTTTGCATCAA

Features of the protein sequence

Length: 1850 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10403 0 100.0 neuron navigato...
synthetic construct
Q80TN7 0 88.0 Neuron navigato...
Mus musculus
EDL21709 0 93.4 mCG20172 [Mus m...
Mus musculus
EDM16755 0 94.9 rCG48939 [Rattu...
Rattus norvegicus
NP_001074504 0 87.7 neuron navigato...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR003593 1513 1667 SM00382 AAA+ ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp