Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00167
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00167
Clone name fh00470s1
Vector information
The cDNA fragment was inserted at the KpnI (blunt ended)-Not ...
Symbol ZC3H7B
cDNA sequence DNA sequence (5735 bp)
Predicted protein sequence (1016 aa)
Flexi ORF Clone FXC00167
Description zinc finger CCCH-type containing 7B
Features of the cloned cDNA sequence

Length: 5735 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2674 bp
Genome contig ID gi89161203f_39927602
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TTTTGTCCTTCTTAAAATAAAATGAAAGAAACTTG
Flanking genome sequence
(158453 - 158502)		 
----+----*----+----*----+----*----+----*----+----*
CTTCCCTTAGCCTTTGTTCTAGAAAATAAACTTGTGCACTTTGACCTCTG

Features of the protein sequence

Length: 1016 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI23515 0 100.0 zinc finger CCC...
 Homo sapiens
BAG37501 0 99.8 unnamed protein...
 Homo sapiens
AAI52559 0 99.5 Zinc finger CCC...
 Homo sapiens
XP_001168979 0 99.0 zinc finger CCC...
 Pan troglodytes
XP_001168953 0 98.0 zinc finger CCC...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 121 154 PF00515 Tetratricopeptide TPR_1
IPR001440 155 188 PF00515 Tetratricopeptide TPR_1
IPR000571 519 545 PF00642 Zinc finger
IPR000571 651 676 PF00642 Zinc finger
IPR000571 794 820 PF00642 Zinc finger
IPR000571 926 952 PF00642 Zinc finger
HMMSmart IPR013026 121 154 SM00028 Tetratricopeptide region
IPR013026 155 188 SM00028 Tetratricopeptide region
IPR000571 520 546 SM00356 Zinc finger
IPR000571 650 676 SM00356 Zinc finger
IPR000571 795 820 SM00356 Zinc finger
IPR000571 927 952 SM00356 Zinc finger
ProfileScan IPR013026 75 108 PS50005 Tetratricopeptide region
IPR013026 121 154 PS50005 Tetratricopeptide region
IPR013026 121 188 PS50293 Tetratricopeptide region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp