ORK00175

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00175

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00175
Clone name	ee06815
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GGA2
cDNA sequence	DNA sequence (3347 bp) Predicted protein sequence (627 aa)
HaloTag ORF Clone	FHC00175
Flexi ORF Clone	FXC00175
Description	ADP-ribosylation factor-binding protein GGA2 (Golgi-localized, gamma ear-containing, ARF-binding protein 2) (Gamma-adaptin-related protein 2) (VHS domain and ear domain of gamma-adaptin) (Vear).

Features of the cloned cDNA sequence

Description

Length: 3347 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1429 bp
Genome contig ID	gi51511732r_23284985
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTTGGAGCTCTTAATTACAATATCTGATATTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGTCTGATCTTTTGACTTCTACATATAGTGGAAATCTGCCAATACTAA

Features of the protein sequence

Description

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF35394	0	100.0	gamma-adaptin r...	Homo sapiens
AAF05708	0	99.8	ADP-ribosylatio...	Homo sapiens
XP_001162100	0	97.2	ADP-ribosylatio...	Pan troglodytes
XP_001162172	2e-212	96.9	ADP-ribosylatio...	Pan troglodytes
XP_001162281	3.4e-212	96.7	ADP-ribosylatio...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002014	39	173	PD003686	VHS
BlastProDom	IPR008153	485	619	PD021457	Clathrin adaptor
HMMPfam	IPR002014	34	173	PF00790	VHS
	IPR004152	237	338	PF03127	GAT
	IPR008152	495	619	PF02883	Clathrin adaptor
HMMSmart	IPR002014	40	173	SM00288	VHS
HMMSmart	IPR008152	495	619	SM00809	Clathrin adaptor
ProfileScan	IPR002014	47	177	PS50179	VHS
	IPR004152	202	329	PS50909	GAT
	IPR008153	498	619	PS50180	Clathrin adaptor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp