Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00177
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00177
Clone name ef01953
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol WHSC1
cDNA sequence DNA sequence (7737 bp)
Predicted protein sequence (1372 aa)
Flexi ORF Clone FXC00177
Description Probable histone-lysine N-methyltransferase NSD2 (EC 2.1.1.43) (Nuclear SET domain-containing protein 2) (Wolf-Hirschhorn syndrome candidate 1 protein) (Multiple myeloma SET domain-containing protein) (Protein trithorax-5).
Features of the cloned cDNA sequence

Length: 7737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3282 bp
Genome contig ID gi89161207f_1743010
PolyA signal sequence
(ATTAAA,-19)		 
+----*----+----*----+----*----+----
GTATGAGTATTTTTGTATTAAAAACATTTTAAAGG
Flanking genome sequence
(210708 - 210757)		 
----+----*----+----*----+----*----+----*----+----*
CTTTTTTCTTAACTTATTTTATATGGGATTGTTTGATTTTTTTTCCAGTT

Features of the protein sequence

Length: 1372 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O96028 0 100.0 Probable histon...
 Homo sapiens
XP_001146084 0 99.8 Wolf-Hirschhorn...
 Pan troglodytes
XP_001488967 0 93.0 Wolf-Hirschhorn...
 Equus caballus
Q8BVE8 0 90.9 Probable histon...
 Mus musculus
XP_001058474 0 90.1 similar to Wolf...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000313 226 302 PF00855 PWWP
IPR000910 465 509 PF00505 HMG1/2 (high mobility group) box
IPR001965 676 720 PF00628 Zinc finger
IPR001965 840 882 PF00628 Zinc finger
IPR000313 884 958 PF00855 PWWP
IPR001214 1064 1193 PF00856 SET
IPR001965 1248 1295 PF00628 Zinc finger
HMMSmart IPR000313 227 292 SM00293 PWWP
IPR000910 459 529 SM00398 HMG1/2 (high mobility group) box
IPR001965 676 718 SM00249 Zinc finger
IPR001841 677 717 SM00184 Zinc finger
IPR001965 723 770 SM00249 Zinc finger
IPR001841 724 769 SM00184 Zinc finger
IPR001965 840 880 SM00249 Zinc finger
IPR000313 885 947 SM00293 PWWP
IPR006560 1018 1069 SM00570 AWS
IPR001214 1070 1193 SM00317 SET
IPR003616 1194 1210 SM00508 Post-SET zinc-binding region
IPR001965 1248 1291 SM00249 Zinc finger
ProfileScan IPR000313 229 293 PS50812 PWWP
IPR000910 460 509 PS50118 HMG1/2 (high mobility group) box
IPR001965 674 720 PS50016 Zinc finger
IPR001841 724 770 PS50089 Zinc finger
IPR001965 838 882 PS50016 Zinc finger
IPR000313 887 949 PS50812 PWWP
IPR006560 1018 1068 PS51215 AWS
IPR001214 1069 1191 PS50280 SET
IPR003616 1194 1210 PS50868 Post-SET zinc-binding region
ScanRegExp IPR001965 677 717 PS01359 Zinc finger
IPR001965 841 879 PS01359 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp