ORK00178

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00178

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00178
Clone name	fj15240
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	OXSR1
cDNA sequence	DNA sequence (4531 bp) Predicted protein sequence (588 aa)
HaloTag ORF Clone	FHC00178
Flexi ORF Clone	FXC00178
Description	Serine/threonine-protein kinase OSR1 (EC 2.7.11.1) (Oxidative stress- responsive 1 protein).

Features of the cloned cDNA sequence

Description

Length: 4531 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2593 bp
Genome contig ID	gi89161205f_38082018
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTCTTCATTTTTAATCAATAAAGAGTAAATTGTC
Flanking genome sequence (189963 - 190012)	----+--------+--------+--------+--------+----* CTTAGTGGTGTATGGACGCTTTATTTTAGTGGCCGTTGGCGGAGAGCTGT

Features of the protein sequence

Description

Length: 588 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95747	4.9e-186	100.0	Serine/threonin...	Homo sapiens
AAQ02425	4.9e-186	100.0	oxidative-stres...	synthetic construct
XP_526174	2.4e-185	99.6	hypothetical pr...	Pan troglodytes
Q5R495	3.5e-185	99.4	Serine/threonin...	Pongo abelii
XP_001488478	1.6e-183	98.2	oxidative-stres...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	78	352	PD000001	Protein kinase
HMMPfam	IPR000719	78	352	PF00069	Protein kinase
HMMSmart	IPR001245	78	352	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	78	352	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	78	352	PS50011	Protein kinase
ScanRegExp	IPR000719	84	107	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp