ORK00194

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00194

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00194
Clone name	ah00154
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IFT172
cDNA sequence	DNA sequence (5419 bp) Predicted protein sequence (1786 aa)
HaloTag ORF Clone	FHC00194
Flexi ORF Clone	FXC00194
Description	selective LIM binding factor homolog

Features of the cloned cDNA sequence

Description

Length: 5419 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	58 bp
Genome contig ID	gi89161199r_27420745
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GGGCCTCTCCCTCATTAAAGTTTTATAAATAATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACCACTGTATTCTTTGATCAAAGTCATTCCCAACACCACACAGTGCCT

Features of the protein sequence

Description

Length: 1786 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UG01	100.0	Intraflagellar ...	Homo sapiens
EAX00571	99.8	intraflagellar ...	Homo sapiens
XP_001097501	99.1	similar to sele...	Macaca mulatta
XP_001502238	95.9	similar to intr...	Equus caballus
EDL37361	95.7	intraflagellar ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	44	81	PF00400	WD40 repeat
HMMSmart	IPR001680	39	81	SM00320	WD40 repeat
	IPR001680	92	131	SM00320	WD40 repeat
	IPR001680	139	176	SM00320	WD40 repeat
	IPR001680	178	217	SM00320	WD40 repeat
	IPR001680	223	260	SM00320	WD40 repeat
	IPR001680	262	304	SM00320	WD40 repeat
	IPR001680	316	351	SM00320	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp