ORK00197

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00197

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00197
Clone name	ah01845
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZBTB47
cDNA sequence	DNA sequence (5223 bp) Predicted protein sequence (745 aa)
HaloTag ORF Clone	FHC00197
Flexi ORF Clone	FXC00197
Description	zinc finger and BTB domain containing 47 (ZBTB47), mRNA

Features of the cloned cDNA sequence

Description

Length: 5223 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2983 bp
Genome contig ID	gi89161205f_42574856
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGGATGAAGGGGAATAAAGTCAGTACAACTCGTG
Flanking genome sequence (109222 - 109271)	----+--------+--------+--------+--------+----* TCCCTTGGCCCAGCCTCTTCTTTGCACTTGGCCTGCCTTGACTCTTGGAC

Features of the protein sequence

Description

Length: 745 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10435	5.3e-188	100.0	zinc finger and...	synthetic construct
XP_001108826	4e-131	91.4	similar to natu...	Macaca mulatta
Q9UFB7	9.1e-108	100.0	Zinc finger and...	Homo sapiens
XP_236722	4.1e-97	83.0	similar to zinc...	Rattus norvegicus
BAC86810	2.1e-95	85.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	630	653	PD000003	Zinc finger
HMMPfam	IPR013069	2	111	PF00651	BTB/POZ
	IPR007087	434	457	PF00096	Zinc finger
	IPR007087	488	511	PF00096	Zinc finger
	IPR007087	518	540	PF00096	Zinc finger
	IPR007087	546	568	PF00096	Zinc finger
	IPR007087	574	596	PF00096	Zinc finger
	IPR007087	602	624	PF00096	Zinc finger
	IPR007087	630	652	PF00096	Zinc finger
	IPR007087	658	680	PF00096	Zinc finger
HMMSmart	IPR000210	15	111	SM00225	BTB/POZ-like
	IPR015880	434	457	SM00355	Zinc finger
	IPR015880	461	481	SM00355	Zinc finger
	IPR015880	488	511	SM00355	Zinc finger
	IPR015880	518	540	SM00355	Zinc finger
	IPR015880	546	568	SM00355	Zinc finger
	IPR015880	574	596	SM00355	Zinc finger
	IPR015880	602	624	SM00355	Zinc finger
	IPR015880	630	652	SM00355	Zinc finger
	IPR015880	658	685	SM00355	Zinc finger
ProfileScan	IPR000210	13	81	PS50097	BTB/POZ-like
	IPR007087	434	462	PS50157	Zinc finger
	IPR007087	488	516	PS50157	Zinc finger
	IPR007087	518	545	PS50157	Zinc finger
	IPR007087	546	573	PS50157	Zinc finger
	IPR007087	574	601	PS50157	Zinc finger
	IPR007087	602	629	PS50157	Zinc finger
	IPR007087	630	657	PS50157	Zinc finger
	IPR007087	658	686	PS50157	Zinc finger
ScanRegExp	IPR007087	436	457	PS00028	Zinc finger
	IPR007087	490	511	PS00028	Zinc finger
	IPR007087	520	540	PS00028	Zinc finger
	IPR007087	548	568	PS00028	Zinc finger
	IPR007087	576	596	PS00028	Zinc finger
	IPR007087	604	624	PS00028	Zinc finger
	IPR007087	632	652	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp