ORK00203

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00203

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00203
Clone name	ef04929
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HEG1
cDNA sequence	DNA sequence (7726 bp) Predicted protein sequence (1489 aa)
HaloTag ORF Clone	FHC00203
Flexi ORF Clone	FXC00203
Description	Protein HEG homolog 1 precursor.

Features of the cloned cDNA sequence

Description

Length: 7726 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3176 bp
Genome contig ID	gi89161205r_126069011
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTAAGAAGTAACCAAATTAGTGACGTGAAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATGCTGACTACCCTTTTGAAAATGTGCTTTCA

Features of the protein sequence

Description

Length: 1489 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10442	0	100.0	HEG homolog 1 [...	synthetic construct
Q9ULI3	0	93.0	Protein HEG hom...	Homo sapiens
XP_516708	1.9e-206	91.5	HEG homolog 1 [...	Pan troglodytes
XP_545138	1.7e-149	68.0	similar to HEG ...	Canis lupus fam...
EDK97849	3.9e-146	57.0	mCG127133, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006209	1097	1130	PF00008	EGF-like
HMMPfam	IPR013091	1133	1170	PF07645	EGF calcium-binding
HMMSmart	IPR001881	1093	1131	SM00179	EGF-like calcium-binding
	IPR006210	1096	1131	SM00181	EGF
	IPR001881	1133	1171	SM00179	EGF-like calcium-binding
	IPR006210	1136	1171	SM00181	EGF
	IPR006210	1291	1339	SM00181	EGF
ProfileScan	IPR000742	1093	1131	PS50026	EGF-like
ProfileScan	IPR000742	1133	1171	PS50026	EGF-like
ScanRegExp	IPR013032	1119	1130	PS00022	EGF-like region
	IPR001881	1126	1157	PS01187	EGF-like calcium-binding
	IPR000152	1148	1159	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	1157	1170	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	WPPPLLLLLLPLLLLMPPAA	35	SECONDARY	20
SOSUI2	2	1357	ITVVIAAAGGGLLLILGIALIVT	1379	PRIMARY	23