ORK00231

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00231

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00231
Clone name	fk08867
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	POLR3E
cDNA sequence	DNA sequence (3626 bp) Predicted protein sequence (742 aa)
HaloTag ORF Clone	FHC00231
Flexi ORF Clone	FXC00231
Description	DNA-directed RNA polymerase III subunit RPC5 (RNA polymerase III subunit C5) (DNA-directed RNA polymerase III 80 kDa polypeptide).

Features of the cloned cDNA sequence

Description

Length: 3626 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1395 bp
Genome contig ID	gi51511732f_22116294
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- ATATGTGAACCTGAAAAGTAAAGTTACCAAAAGCG
Flanking genome sequence (137625 - 137674)	----+--------+--------+--------+--------+----* ATTTGGAATATGTCTCAGCTTTTCCATCCTACTTCCTTCTCACTTTGAAA

Features of the protein sequence

Description

Length: 742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511201	96.9	hypothetical pr...	Pan troglodytes
Q9NVU0	100.0	DNA-directed RN...	Homo sapiens
AAM18215	99.8	RNA polymerase ...	Homo sapiens
BAD96509	99.8	polymerase (RNA...	Homo sapiens
EAW50607	99.2	polymerase (RNA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006886	38	468	PF04801	Sin-like protein conserved region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp