Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00237
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00237
Clone name ef04341
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RACGAP1
cDNA sequence DNA sequence (3054 bp)
Predicted protein sequence (635 aa)
Flexi ORF Clone FXC00237
Description Rac GTPase-activating protein 1 (MgcRacGAP).
Features of the cloned cDNA sequence

Length: 3054 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1104 bp
Genome contig ID gi89161190r_48569214
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
TATTTGGAAAAAAAGTAAATAGCTTTTTCAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATGAGGCTGGTTTTCTTGTCTTGCAAGGTAATTTTCAATGCCTTTTA

Features of the protein sequence

Length: 635 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H0H5 0 100.0 Rac GTPase-acti...
Homo sapiens
BAA90247 0 99.8 GTPase activati...
Homo sapiens
XP_001156917 0 99.5 hypothetical pr...
Pan troglodytes
BAG38131 0 99.8 unnamed protein...
Homo sapiens
BAA91347 0 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002219 290 341 PF00130 Protein kinase C
IPR000198 366 516 PF00620 RhoGAP
HMMSmart IPR002219 290 338 SM00109 Protein kinase C
IPR000198 363 539 SM00324 RhoGAP
ProfileScan IPR002219 289 338 PS50081 Protein kinase C
IPR000198 352 542 PS50238 RhoGAP
ScanRegExp IPR002219 290 338 PS00479 Protein kinase C
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp