ORK00239

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00239

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00239
Clone name	ek00381
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KBTBD2
cDNA sequence	DNA sequence (3423 bp) Predicted protein sequence (627 aa)
HaloTag ORF Clone	FHC00239
Flexi ORF Clone	FXC00239
Description	Kelch repeat and BTB domain-containing protein 2 (BTB and kelch domain-containing protein 1).

Features of the cloned cDNA sequence

Description

Length: 3423 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1171 bp
Genome contig ID	gi89161213r_32774311
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGACATTAATTTATTAAATAAATTGTATATATTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATATCTATTTTTCTTTTGTTATGGGAATGGTCTGCTTTTTAAATTTTGA

Features of the protein sequence

Description

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IY47	100.0	Kelch repeat an...	Homo sapiens
XP_001167893	99.8	kelch repeat an...	Pan troglodytes
AAH37887	99.6	Kelch repeat an...	Homo sapiens
Q5RDY3	99.5	Kelch repeat an...	Pongo abelii
XP_001500923	99.5	similar to Kelc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	25	132	PF00651	BTB/POZ
	IPR011705	137	238	PF07707	BTB/Kelch-associated
	IPR006652	314	371	PF01344	Kelch repeat type 1
	IPR006652	373	420	PF01344	Kelch repeat type 1
	IPR006652	462	520	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	35	132	SM00225	BTB/POZ-like
	IPR006652	321	384	SM00612	Kelch repeat type 1
	IPR006652	385	433	SM00612	Kelch repeat type 1
	IPR006652	434	473	SM00612	Kelch repeat type 1
	IPR006652	474	536	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	35	102	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	424	QWSAAVVVHDCIYVMTLNLMYC	445	PRIMARY	22