ORK00264

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00264

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00264
Clone name	fg04234
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLHL15
cDNA sequence	DNA sequence (6260 bp) Predicted protein sequence (605 aa)
HaloTag ORF Clone	FHC00264
Flexi ORF Clone	FXC00264
Description	Kelch-like protein 15.

Features of the cloned cDNA sequence

Description

Length: 6260 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4197 bp
Genome contig ID	gi89161218r_23811762
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAAGAAAAGTTTAAATAAAATATTTTTAATCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATACTTCTTTATCTCTGATTATTTGCTGTTTTTTGATATAATCCA

Features of the protein sequence

Description

Length: 605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96M94	100.0	Kelch-like prot...	Homo sapiens
XP_001089787	99.8	similar to kelc...	Macaca mulatta
BAB71415	99.8	unnamed protein...	Homo sapiens
CAM26498	99.3	kelch-like 15 (...	Mus musculus
XP_548897	99.0	similar to kelc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	22	129	PF00651	BTB/POZ
	IPR011705	134	238	PF07707	BTB/Kelch-associated
	IPR006652	317	367	PF01344	Kelch repeat type 1
	IPR006652	369	414	PF01344	Kelch repeat type 1
	IPR006652	416	476	PF01344	Kelch repeat type 1
	IPR006652	478	530	PF01344	Kelch repeat type 1
	IPR006652	532	578	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	32	129	SM00225	BTB/POZ-like
	IPR006652	329	380	SM00612	Kelch repeat type 1
	IPR006652	381	427	SM00612	Kelch repeat type 1
	IPR006652	428	489	SM00612	Kelch repeat type 1
	IPR006652	490	543	SM00612	Kelch repeat type 1
	IPR006652	544	593	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	32	99	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	109	AMYVQLIEVVKFCCSFLLAKICL	131	PRIMARY	23