Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00272
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00272
Clone name ef01524
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SETD2
cDNA sequence DNA sequence (8593 bp)
Predicted protein sequence (2645 aa)
Flexi ORF Clone FXC00272
Description Histone-lysine N-methyltransferase SETD2 (EC 2.1.1.43) (SET domain- containing protein 2) (hSET2) (Huntingtin-interacting protein HYPB) (Huntingtin yeast partner B) (Huntingtin-interacting protein 1) (HIF- 1) (p231HBP).
Features of the cloned cDNA sequence

Length: 8593 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 655 bp
Genome contig ID gi89161205r_46932932
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
GAACTTTTTATGTAAAAAAATAAAATCAATTAAAG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AACTTGGCATGTGTGTTCCCTAAAAGTTAATCAAGCATATTTGTGTGTAA

Features of the protein sequence

Length: 2645 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10485 0 100.0 SET domain-cont...
 synthetic construct
Q9BYW2 0 96.9 Histone-lysine ...
 Homo sapiens
XP_001153009 0 93.3 hypothetical pr...
 Pan troglodytes
XP_516423 0 96.6 huntingtin inte...
 Pan troglodytes
XP_001153070 0 96.5 huntingtin inte...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001214 1547 1754 PF00856 SET
IPR001202 2472 2501 PF00397 WW/Rsp5/WWP
IPR015119 2540 2636 PF09031 Set2-Rpb1 interacting
HMMSmart IPR006560 1497 1552 SM00570 AWS
IPR001214 1553 1754 SM00317 SET
IPR003616 1755 1771 SM00508 Post-SET zinc-binding region
IPR001202 2471 2503 SM00456 WW/Rsp5/WWP
ProfileScan IPR006560 1497 1551 PS51215 AWS
IPR001214 1552 1752 PS50280 SET
IPR003616 1755 1771 PS50868 Post-SET zinc-binding region
IPR001202 2470 2503 PS50020 WW/Rsp5/WWP
ScanRegExp IPR001670 240 267 PS00913 Iron-containing alcohol dehydrogenase
IPR001202 2476 2501 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp