Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00277
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00277
Clone name fj15684
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SETD5
cDNA sequence DNA sequence (4920 bp)
Predicted protein sequence (1391 aa)
Flexi ORF Clone FXC00277
Description SET domain-containing protein 5.
Features of the cloned cDNA sequence

Length: 4920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 368 bp
Genome contig ID gi89161205f_9345519
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTCACTTGTGCAGTGAGGACATCTTTTTAAATTT
Flanking genome sequence
(147626 - 147675)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGTTTTCAAAGGAAAAAAAGTTAAAAGAGCCA

Features of the protein sequence

Length: 1391 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9C0A6 0 100.0 SET domain-cont...
Homo sapiens
XP_001495486 0 95.5 SET domain cont...
Equus caballus
EAW63961 0 100.0 hCG1759124, iso...
Homo sapiens
EAW63963 0 98.1 hCG1759124, iso...
Homo sapiens
EAW63962 0 100.0 hCG1759124, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001214 216 346 PF00856 SET
HMMSmart IPR001214 221 345 SM00317 SET
ProfileScan IPR001214 235 343 PS50280 SET
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp