Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00278
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00278
Clone name ah01627
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZFHX2
cDNA sequence DNA sequence (5745 bp)
Predicted protein sequence (1556 aa)
Description Zinc finger homeobox protein 2 (Zinc finger homeodomain protein 2) (ZFH-2).
Features of the cloned cDNA sequence

Length: 5745 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1072 bp
Genome contig ID gi51511730r_22959939
PolyA signal sequence
(AAGAAA,-26)		 
+----*----+----*----+----*----+----
AATGAACTAAAGAAAAACGTAAACTTGGAAAATAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGAAAAAAAAAAAAAGGAAGAAAACTCCCATCAGACAAGTGTTTTTTTTC

Features of the protein sequence

Length: 1556 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10489 0 100.0 zinc finger hom...
 synthetic construct
EAW66143 0 100.0 zinc finger hom...
 Homo sapiens
EAW66145 0 100.0 zinc finger hom...
 Homo sapiens
XP_001715032 0 100.0 zinc finger hom...
 Homo sapiens
Q9C0A1 0 100.0 Zinc finger hom...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001356 579 636 PD000010 Homeobox
IPR001356 841 900 PD000010 Homeobox
IPR001356 1049 1106 PD000010 Homeobox
HMMPfam IPR007087 175 199 PF00096 Zinc finger
IPR007087 232 256 PF00096 Zinc finger
IPR001356 580 636 PF00046 Homeobox
IPR007087 753 775 PF00096 Zinc finger
IPR001356 842 898 PF00046 Homeobox
IPR001356 1050 1106 PF00046 Homeobox
HMMSmart IPR003604 172 206 SM00451 Zinc finger
IPR015880 175 199 SM00355 Zinc finger
IPR003604 229 263 SM00451 Zinc finger
IPR015880 232 256 SM00355 Zinc finger
IPR015880 464 487 SM00355 Zinc finger
IPR001356 579 641 SM00389 Homeobox
IPR015880 753 775 SM00355 Zinc finger
IPR001356 841 903 SM00389 Homeobox
IPR001356 1049 1111 SM00389 Homeobox
IPR003604 1127 1161 SM00451 Zinc finger
IPR015880 1130 1154 SM00355 Zinc finger
IPR003604 1476 1510 SM00451 Zinc finger
IPR015880 1479 1503 SM00355 Zinc finger
ProfileScan IPR007087 175 206 PS50157 Zinc finger
IPR007087 232 261 PS50157 Zinc finger
IPR007087 464 492 PS50157 Zinc finger
IPR001356 577 637 PS50071 Homeobox
IPR007087 753 775 PS50157 Zinc finger
IPR001356 839 899 PS50071 Homeobox
IPR001356 1047 1107 PS50071 Homeobox
ScanRegExp IPR007087 177 199 PS00028 Zinc finger
IPR007087 234 256 PS00028 Zinc finger
IPR007087 466 487 PS00028 Zinc finger
IPR007087 755 775 PS00028 Zinc finger
IPR001356 874 897 PS00027 Homeobox
IPR007087 1132 1154 PS00028 Zinc finger
IPR007087 1481 1503 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp