ORK00279

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00279

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00279
Clone name	fh17343
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IKZF4
cDNA sequence	DNA sequence (5072 bp) Predicted protein sequence (549 aa)
HaloTag ORF Clone	FHC00279
Flexi ORF Clone	FXC00279
Description	zinc finger protein, subfamily 1A, 4

Features of the cloned cDNA sequence

Description

Length: 5072 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3098 bp
Genome contig ID	gi89161190f_54587550
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GCTGAAAGTCTGTTATAAATAAACATGAGTAATTT
Flanking genome sequence (130932 - 130981)	----+--------+--------+--------+--------+----* AACACCTCTGGTTGTTTTTGCAGACTTCCTTTGCCTTGCTTTTCTACTAA

Features of the protein sequence

Description

Length: 549 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10493	7.6e-199	100.0	zinc finger pro...	synthetic construct
EAW96872	4.1e-194	97.5	zinc finger pro...	Homo sapiens
EAW96874	1.9e-193	99.2	zinc finger pro...	Homo sapiens
Q9H2S9	2e-193	99.2	Zinc finger pro...	Homo sapiens
XP_001113514	8e-193	99.0	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	151	173	PF00096	Zinc finger
	IPR007087	179	201	PF00096	Zinc finger
	IPR007087	212	235	PF00096	Zinc finger
HMMSmart	IPR015880	123	145	SM00355	Zinc finger
	IPR015880	151	173	SM00355	Zinc finger
	IPR015880	179	201	SM00355	Zinc finger
	IPR015880	212	235	SM00355	Zinc finger
	IPR015880	494	516	SM00355	Zinc finger
	IPR015880	522	546	SM00355	Zinc finger
ProfileScan	IPR007087	123	150	PS50157	Zinc finger
	IPR007087	151	178	PS50157	Zinc finger
	IPR007087	179	206	PS50157	Zinc finger
	IPR007087	212	240	PS50157	Zinc finger
ScanRegExp	IPR007087	125	145	PS00028	Zinc finger
	IPR007087	153	173	PS00028	Zinc finger
	IPR007087	181	201	PS00028	Zinc finger
	IPR007087	214	235	PS00028	Zinc finger
	IPR007087	496	516	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp