ORK00283

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00283

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00283
Clone name	fk00014s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF512
cDNA sequence	DNA sequence (3343 bp) Predicted protein sequence (570 aa)
HaloTag ORF Clone	FHC00283
Flexi ORF Clone	FXC00283
Description	zinc finger protein 512

Features of the cloned cDNA sequence

Description

Length: 3343 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1630 bp
Genome contig ID	gi89161199f_27559475
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GTTTGGCAATGACAAAAGAAATAAATGACTCTCAG
Flanking genome sequence (139989 - 140038)	----+--------+--------+--------+--------+----* AAAGATGTTTCCAGTGTTCTTTGACGCCGACCTGCTGCATGACTCCTTGA

Features of the protein sequence

Description

Length: 570 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96ME7	100.0	Zinc finger pro...	Homo sapiens
Q5R6F3	99.8	Zinc finger pro...	Pongo abelii
BAB71348	99.8	unnamed protein...	Homo sapiens
EAX00563	99.8	zinc finger pro...	Homo sapiens
Q95JV5	99.4	Zinc finger pro...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	200	223	PF00096	Zinc finger
	IPR007087	290	313	PF00096	Zinc finger
	IPR007087	443	466	PF00096	Zinc finger
HMMSmart	IPR015880	200	223	SM00355	Zinc finger
	IPR015880	290	313	SM00355	Zinc finger
	IPR015880	409	431	SM00355	Zinc finger
	IPR015880	443	466	SM00355	Zinc finger
ProfileScan	IPR007087	290	313	PS50157	Zinc finger
ProfileScan	IPR007087	443	471	PS50157	Zinc finger
ScanRegExp	IPR007087	202	223	PS00028	Zinc finger
	IPR007087	292	313	PS00028	Zinc finger
	IPR007087	445	466	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp