ORK00301

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00301

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00301
Clone name	fk00837s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITIH5
cDNA sequence	DNA sequence (3522 bp) Predicted protein sequence (954 aa)
HaloTag ORF Clone	FHC00301
Flexi ORF Clone	FXC00301
Description	inter-alpha (globulin) inhibitor H5

Features of the cloned cDNA sequence

Description

Length: 3522 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	656 bp
Genome contig ID	gi89161187r_7544395
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TAGTTTTCATTAAAAAGAAATTTGATTGAAAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACATCTACAGCTCAGATACTGATCTCTTTCTAATGGGCTTTGTAAACC

Features of the protein sequence

Description

Length: 954 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW86379	100.0	inter-alpha (gl...	Homo sapiens
Q86UX2	99.8	Inter-alpha-try...	Homo sapiens
AAO49812	99.7	inter-alpha try...	Homo sapiens
BAB55070	99.6	unnamed protein...	Homo sapiens
CAI12955	99.4	inter-alpha (gl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	306	323	PR00453	von Willebrand factor
FPrintScan	IPR002035	412	420	PR00453	von Willebrand factor
HMMPfam	IPR013694	59	173	PF08487	Vault protein inter-alpha-trypsin
	IPR002035	307	490	PF00092	von Willebrand factor
	IPR010600	727	921	PF06668	Inter-alpha-trypsin inhibitor heavy chain
HMMSmart	IPR006587	56	173	SM00609	Vault protein inter-alpha-trypsin
HMMSmart	IPR002035	305	488	SM00327	von Willebrand factor
ProfileScan	IPR002035	307	490	PS50234	von Willebrand factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp