ORK00304

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00304

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00304
Clone name	af29273
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	AGAP11
cDNA sequence	DNA sequence (7317 bp) Predicted protein sequence (588 aa)
HaloTag ORF Clone	FHC00304
Flexi ORF Clone	FXC00304
Description

Features of the cloned cDNA sequence

Description

Length: 7317 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	300 bp
Genome contig ID	gi89161187f_88629297
PolyA signal sequence (AATATA,-23)	+--------+--------+----*----+---- AAGATGTGTGAAAATATATTTGAAAAAAAGTTCAT
Flanking genome sequence (130647 - 130696)	----+--------+--------+--------+--------+----* AAATATGCATTGATTTTTGTACATATGGCACCTCTTTTTCATTTTTATTT

Features of the protein sequence

Description

Length: 588 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW80309	6e-193	100.0	hCG1994053, iso...	Homo sapiens
XP_001082744	1e-174	82.3	similar to cent...	Macaca mulatta
NP_055729	1.6e-174	82.5	arf-GAP with GT...	Homo sapiens
EAW71079	1.9e-174	82.3	centaurin, gamm...	Homo sapiens
AAL04172	4.6e-174	82.1	centaurin gamma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	378	397	PR00405	Arf GTPase activating protein
	IPR001164	397	414	PR00405	Arf GTPase activating protein
	IPR001164	418	439	PR00405	Arf GTPase activating protein
	IPR002110	526	538	PR01415	Ankyrin
	IPR002110	571	583	PR01415	Ankyrin
HMMPfam	IPR001849	160	345	PF00169	Pleckstrin-like
	IPR001164	366	486	PF01412	Arf GTPase activating protein
	IPR002110	525	557	PF00023	Ankyrin
	IPR002110	558	583	PF00023	Ankyrin
HMMSmart	IPR001849	160	347	SM00233	Pleckstrin-like
	IPR001164	366	486	SM00105	Arf GTPase activating protein
	IPR002110	525	554	SM00248	Ankyrin
	IPR002110	558	587	SM00248	Ankyrin
ProfileScan	IPR001849	159	345	PS50003	Pleckstrin-like
	IPR001164	366	486	PS50115	Arf GTPase activating protein
	IPR002110	493	582	PS50297	Ankyrin
	IPR002110	525	557	PS50088	Ankyrin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp