ORK00306

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00306

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00306
Clone name	eg00089
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ARHGEF28
cDNA sequence	DNA sequence (6219 bp) Predicted protein sequence (1746 aa)
HaloTag ORF Clone	FHC00306
Flexi ORF Clone	FXC00306
Description	Rho-guanine nucleotide exchange factor

Features of the cloned cDNA sequence

Description

Length: 6219 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	976 bp
Genome contig ID	gi51511721f_72857790
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATGTATTTTGGTGTCAATAAATATCTTGTACCTC
Flanking genome sequence (415782 - 415831)	----+--------+--------+--------+--------+----* ATTATTTTACTTTGTAATTTTAACATTATGTGTAGGACCATAGTAAAACA

Features of the protein sequence

Description

Length: 1746 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N1W1	99.5	Rho-guanine nuc...	Homo sapiens
XP_001151367	98.5	similar to Rho-...	Pan troglodytes
XP_001151300	98.2	similar to Rho-...	Pan troglodytes
AAI57847	98.2	RGNEF protein [...	Homo sapiens
AAI67854	99.6	Rho-guanine nuc...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	694	744	PF00130	Protein kinase C
	IPR000219	894	1084	PF00621	DH
	IPR001849	1128	1229	PF00169	Pleckstrin-like
HMMSmart	IPR002219	694	740	SM00109	Protein kinase C
	IPR000219	894	1084	SM00325	DH
	IPR001849	1128	1231	SM00233	Pleckstrin-like
ProfileScan	IPR002219	693	740	PS50081	Protein kinase C
	IPR000219	890	1085	PS50010	DH
	IPR001849	1127	1229	PS50003	Pleckstrin-like
ScanRegExp	IPR002219	694	740	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp