ORK00307

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00307

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00307
Clone name	fk03255
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MEX3B
cDNA sequence	DNA sequence (3366 bp) Predicted protein sequence (652 aa)
HaloTag ORF Clone	FHC00307
Flexi ORF Clone	FXC00307
Description	RNA-binding protein MEX3B (RING finger and KH domain-containing protein 3) (RING finger protein 195).

Features of the cloned cDNA sequence

Description

Length: 3366 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1322 bp
Genome contig ID	gi51511731r_80021234
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTAAAGTTCTACATAATAAAGGTAAAACTTAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGTGCTACTTCATTTTTTAAGTATTTCTATATAAATAAAATATTGAA

Features of the protein sequence

Description

Length: 652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_218846	5.2e-183	93.6	similar to ring...	Rattus norvegicus
Q6ZN04	3.4e-172	100.0	RNA-binding pro...	Homo sapiens
AAH36211	1.6e-171	99.6	MEX3B protein [...	Homo sapiens
CAL37893	3e-171	99.4	hypothetical pr...	synthetic construct
CAL38674	3e-171	99.4	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	150	210	PF00013	K Homology
	IPR004088	245	304	PF00013	K Homology
	IPR001841	601	640	PF00097	Zinc finger
HMMSmart	IPR004087	147	215	SM00322	K Homology
	IPR004087	242	309	SM00322	K Homology
	IPR001841	601	640	SM00184	Zinc finger
ProfileScan	IPR004088	158	210	PS50084	K Homology
	IPR004088	243	304	PS50084	K Homology
	IPR001841	601	641	PS50089	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp