Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00315
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00315
Clone name bg00217
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol KALRN
cDNA sequence DNA sequence (6469 bp)
Predicted protein sequence (1658 aa)
Flexi ORF Clone FXC00315
Description Kalirin (Huntingtin-associated protein-interacting protein) (Protein Duo).
Features of the cloned cDNA sequence

Length: 6469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1387 bp
Genome contig ID gi89161205f_125196258
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TTCTTGAATGTGTTCTAATAAAATGATTCTAAAGC
Flanking genome sequence
(525130 - 525179)		 
----+----*----+----*----+----*----+----*----+----*
AGGCTGTTGATATACAGTGATTTATAAATACTTTCTGTTGAGTGCTGAGG

Features of the protein sequence

Length: 1658 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW79423 0 100.0 hCG2022551, iso...
 Homo sapiens
CAM18309 0 98.9 kalirin, RhoGEF...
 Mus musculus
AAF69144 0 98.9 Kalirin-7c isof...
 Rattus norvegicus
EAW79415 0 100.0 hCG2022551, iso...
 Homo sapiens
XP_001481078 0 98.9 kalirin, RhoGEF...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002017 192 312 PF00435 Spectrin repeat
IPR002017 314 420 PF00435 Spectrin repeat
IPR002017 540 646 PF00435 Spectrin repeat
IPR002017 894 999 PF00435 Spectrin repeat
IPR002017 1125 1217 PF00435 Spectrin repeat
IPR000219 1280 1450 PF00621 DH
IPR001849 1470 1575 PF00169 Pleckstrin-like
HMMSmart IPR001251 42 181 SM00516 Cellular retinaldehyde-binding/triple function
IPR002017 195 311 SM00150 Spectrin repeat
IPR002017 317 419 SM00150 Spectrin repeat
IPR002017 422 537 SM00150 Spectrin repeat
IPR002017 543 645 SM00150 Spectrin repeat
IPR002017 648 770 SM00150 Spectrin repeat
IPR002017 897 998 SM00150 Spectrin repeat
IPR002017 1128 1230 SM00150 Spectrin repeat
IPR000219 1280 1450 SM00325 DH
IPR001849 1464 1577 SM00233 Pleckstrin-like
ProfileScan IPR001251 39 184 PS50191 Cellular retinaldehyde-binding/triple function
IPR000219 1276 1451 PS50010 DH
IPR001849 1463 1575 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp