Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00317
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210024
Product ID ORK00317
Clone name ha04696
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol NUP153
cDNA sequence DNA sequence (5808 bp)
Predicted protein sequence (1455 aa)
Flexi ORF Clone FXC00317
Description Nuclear pore complex protein Nup153 (Nucleoporin Nup153) (153 kDa nucleoporin).
Features of the cloned cDNA sequence

Length: 5808 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1059 bp
Genome contig ID gi89161210r_17623248
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
ATGGGATAAATGCCATCAATAAAAAATTATGACAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTTTTTGTTCTAGTTTTACCTCATAATGAAGGCACACAGTATTATTGGG

Features of the protein sequence

Length: 1455 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06106 0 100.0 NUP153 variant ...
 Homo sapiens
BAG10531 0 100.0 nucleoporin 153...
 synthetic construct
XP_001170663 0 99.2 nucleoporin 153...
 Pan troglodytes
CAI16393 0 97.1 nucleoporin 153...
 Homo sapiens
AAH52965 0 97.0 Nucleoporin 153...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013913 135 614 PF08604 Nucleoporin
IPR001876 637 667 PF00641 Zinc finger
IPR001876 702 731 PF00641 Zinc finger
IPR001876 773 802 PF00641 Zinc finger
IPR001876 831 860 PF00641 Zinc finger
HMMSmart IPR001876 640 664 SM00547 Zinc finger
IPR001876 704 728 SM00547 Zinc finger
IPR001876 775 799 SM00547 Zinc finger
IPR001876 833 857 SM00547 Zinc finger
ProfileScan IPR001876 637 667 PS50199 Zinc finger
IPR001876 702 731 PS50199 Zinc finger
IPR001876 773 802 PS50199 Zinc finger
IPR001876 831 860 PS50199 Zinc finger
ScanRegExp IPR000194 166 175 PS00152 ATPase
IPR001876 642 661 PS01358 Zinc finger
IPR001876 706 725 PS01358 Zinc finger
IPR001876 777 796 PS01358 Zinc finger
IPR001876 835 854 PS01358 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp