ORK00318

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00318

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00318
Clone name	hg00926
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TJP1
cDNA sequence	DNA sequence (6727 bp) Predicted protein sequence (1761 aa)
HaloTag ORF Clone	FHC00318
Flexi ORF Clone	FXC00318
Description	Tight junction protein ZO-1 (Zonula occludens 1 protein) (Zona occludens 1 protein) (Tight junction protein 1).

Features of the cloned cDNA sequence

Description

Length: 6727 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1441 bp
Genome contig ID	gi51511731r_27679651
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATTTCTAAATCTCCAAAATAAAACTTTTTAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTGCTGGCTTGGTCTGTTTGCCCACTGTTTTCTAGTTTCATGCAGCT

Features of the protein sequence

Description

Length: 1761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF95000	100.0	tight junction ...	Homo sapiens
XP_001163195	99.9	tight junction ...	Pan troglodytes
EAW51506	100.0	tight junction ...	Homo sapiens
XP_001163258	99.9	tight junction ...	Pan troglodytes
BAG10532	100.0	tight junction ...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR005417	243	265	PR01597	Zona occludens protein
	IPR005418	337	358	PR01598	Zona occludens protein ZO-1
	IPR005418	360	385	PR01598	Zona occludens protein ZO-1
	IPR005417	591	602	PR01597	Zona occludens protein
	IPR005417	827	837	PR01597	Zona occludens protein
	IPR005417	860	874	PR01597	Zona occludens protein
	IPR005418	1052	1074	PR01598	Zona occludens protein ZO-1
	IPR005418	1507	1528	PR01598	Zona occludens protein ZO-1
HMMPfam	IPR001478	16	100	PF00595	PDZ/DHR/GLGF
	IPR001478	179	254	PF00595	PDZ/DHR/GLGF
	IPR001478	416	494	PF00595	PDZ/DHR/GLGF
	IPR011511	513	575	PF07653	Variant SH3
	IPR008144	686	731	PF00625	Guanylate kinase
	IPR000906	1625	1730	PF00791	ZU5
HMMSmart	IPR001478	25	103	SM00228	PDZ/DHR/GLGF
	IPR001478	189	257	SM00228	PDZ/DHR/GLGF
	IPR001478	424	497	SM00228	PDZ/DHR/GLGF
	IPR008145	599	787	SM00072	Guanylate kinase/L-type calcium channel region
	IPR000906	1625	1730	SM00218	ZU5
ProfileScan	IPR001478	16	103	PS50106	PDZ/DHR/GLGF
	IPR001478	179	257	PS50106	PDZ/DHR/GLGF
	IPR001478	414	495	PS50106	PDZ/DHR/GLGF
	IPR001452	509	577	PS50002	Src homology-3
	IPR008144	683	784	PS50052	Guanylate kinase
	IPR000906	1625	1737	PS51145	ZU5

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp