ORK00322

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00322

Order Kazusa clone(s) from :

Accession No	AB210002
Product ID	ORK00322
Clone name	fg01236
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PI4KA
cDNA sequence	DNA sequence (6711 bp) Predicted protein sequence (2121 aa)
HaloTag ORF Clone	FHC00322
Flexi ORF Clone	FXC00322
Description	Phosphatidylinositol 4-kinase alpha (EC 2.7.1.67) (PI4-kinase alpha) (PtdIns-4-kinase alpha) (PI4K-alpha).

Features of the cloned cDNA sequence

Description

Length: 6711 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	345 bp
Genome contig ID	gi89161203r_19291990
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AACCAACATCAACAAAATAAAAACCCAAAATAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTGTGTTGGAATCTGTGAGGTTTTGTGTCAAGTCCTAAGTCCACCTTCAG

Features of the protein sequence

Description

Length: 2121 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06084	100.0	PIK4CA variant ...	Homo sapiens
XP_525639	99.4	phosphatidylino...	Pan troglodytes
BAG10559	100.0	phosphatidylino...	synthetic construct
NP_477352	100.0	phosphatidylino...	Homo sapiens
P42356	99.9	Phosphatidylino...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001263	1578	1747	PF00613	Phosphoinositide 3-kinase accessory region PIK
HMMPfam	IPR000403	1863	2070	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR001263	1560	1748	SM00145	Phosphoinositide 3-kinase accessory region PIK
HMMSmart	IPR000403	1865	2118	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR000403	1864	2121	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR001395	57	72	PS00063	Aldo/keto reductase
	IPR000403	1868	1882	PS00915	Phosphatidylinositol 3- and 4-kinase
	IPR000403	1961	1981	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp