Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00324
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00324
Clone name sh02642
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYOM2
cDNA sequence DNA sequence (4945 bp)
Predicted protein sequence (1486 aa)
Flexi ORF Clone FXC00324
Description Myomesin-2 (M-protein) (165 kDa titin-associated protein) (165 kDa connectin-associated protein).
Features of the cloned cDNA sequence

Length: 4945 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 474 bp
Genome contig ID gi51511724f_1880630
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTCTCTTGCTTTAGGCAAATAAAAGTTTAAAAATC
Flanking genome sequence
(200158 - 200207)
----+----*----+----*----+----*----+----*----+----*
ACCTTGTTGTGGTTTTCCTGTACCAAATCACACCTACCTGCCCCTGCTCA

Features of the protein sequence

Length: 1486 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10566 0 100.0 myomesin-2 [syn...
synthetic construct
AAH52969 0 99.9 Myomesin (M-pro...
Homo sapiens
NP_003961 0 99.7 myomesin-2 [Hom...
Homo sapiens
EAW51490 0 99.6 myomesin (M-pro...
Homo sapiens
P54296 0 99.4 Myomesin-2; Myo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003962 546 555 PR00014 Fibronectin
IPR003962 760 770 PR00014 Fibronectin
IPR003962 784 802 PR00014 Fibronectin
IPR003962 904 918 PR00014 Fibronectin
HMMPfam IPR013098 175 267 PF07679 Immunoglobulin I-set
IPR013098 299 393 PF07679 Immunoglobulin I-set
IPR003961 404 490 PF00041 Fibronectin
IPR003961 532 618 PF00041 Fibronectin
IPR003961 633 717 PF00041 Fibronectin
IPR003961 732 818 PF00041 Fibronectin
IPR003961 834 920 PF00041 Fibronectin
IPR013098 1366 1456 PF07679 Immunoglobulin I-set
HMMSmart IPR003599 181 268 SM00409 Immunoglobulin subtype
IPR003598 191 257 SM00408 Immunoglobulin subtype 2
IPR003599 305 394 SM00409 Immunoglobulin subtype
IPR003598 311 383 SM00408 Immunoglobulin subtype 2
IPR003961 404 487 SM00060 Fibronectin
IPR003961 532 615 SM00060 Fibronectin
IPR003961 633 714 SM00060 Fibronectin
IPR003961 732 815 SM00060 Fibronectin
IPR003961 834 917 SM00060 Fibronectin
IPR003599 934 1020 SM00409 Immunoglobulin subtype
IPR003599 1156 1236 SM00409 Immunoglobulin subtype
IPR003599 1372 1457 SM00409 Immunoglobulin subtype
IPR003598 1378 1446 SM00408 Immunoglobulin subtype 2
ProfileScan IPR007110 175 266 PS50835 Immunoglobulin-like
IPR007110 287 375 PS50835 Immunoglobulin-like
IPR003961 404 496 PS50853 Fibronectin
IPR003961 532 624 PS50853 Fibronectin
IPR003961 633 723 PS50853 Fibronectin
IPR003961 732 824 PS50853 Fibronectin
IPR003961 834 926 PS50853 Fibronectin
IPR007110 925 1023 PS50835 Immunoglobulin-like
IPR007110 1151 1232 PS50835 Immunoglobulin-like
IPR007110 1379 1455 PS50835 Immunoglobulin-like
ScanRegExp IPR000834 19 29 PS00133 Peptidase M14
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp