Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00326
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226047
Product ID ORK00326
Clone name fj13132
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF202
cDNA sequence DNA sequence (3960 bp)
Predicted protein sequence (660 aa)
Flexi ORF Clone FXC00326
Description Zinc finger protein 202 (Zinc finger protein with KRAB and SCAN domains 10).
Features of the cloned cDNA sequence

Length: 3960 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1650 bp
Genome contig ID gi51511727r_123000265
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
TATACATATATGAAATAAATAAAGGTAACACTTGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGCCAAGTTCCCTGGTTTCTGGGACTTCCCATCTTACCCATTCCTTTTCC

Features of the protein sequence

Length: 660 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAC79941 0 100.0 ZNF202 beta [Ho...
 Homo sapiens
O95125 0 99.8 Zinc finger pro...
 Homo sapiens
BAG51223 0 99.8 unnamed protein...
 Homo sapiens
XP_001136542 0 99.3 zinc finger pro...
 Pan troglodytes
CAC21447 0 99.5 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 409 432 PD000003 Zinc finger
IPR007087 437 459 PD000003 Zinc finger
IPR007087 493 516 PD000003 Zinc finger
IPR007087 521 543 PD000003 Zinc finger
IPR007087 607 628 PD000003 Zinc finger
IPR007087 633 656 PD000003 Zinc finger
HMMPfam IPR003309 52 147 PF02023 Transcriptional regulator SCAN
IPR001909 249 289 PF01352 KRAB box
IPR007087 409 431 PF00096 Zinc finger
IPR007087 437 459 PF00096 Zinc finger
IPR007087 493 515 PF00096 Zinc finger
IPR007087 521 543 PF00096 Zinc finger
IPR007087 577 599 PF00096 Zinc finger
IPR007087 605 627 PF00096 Zinc finger
IPR007087 633 655 PF00096 Zinc finger
HMMSmart IPR003309 54 166 SM00431 Transcriptional regulator SCAN
IPR001909 249 309 SM00349 KRAB box
IPR015880 409 431 SM00355 Zinc finger
IPR015880 437 459 SM00355 Zinc finger
IPR015880 493 515 SM00355 Zinc finger
IPR015880 521 543 SM00355 Zinc finger
IPR015880 549 571 SM00355 Zinc finger
IPR015880 577 599 SM00355 Zinc finger
IPR015880 605 627 SM00355 Zinc finger
IPR015880 633 655 SM00355 Zinc finger
ProfileScan IPR003309 58 139 PS50804 Transcriptional regulator SCAN
IPR001909 249 320 PS50805 KRAB box
IPR007087 409 436 PS50157 Zinc finger
IPR007087 437 464 PS50157 Zinc finger
IPR007087 493 520 PS50157 Zinc finger
IPR007087 521 548 PS50157 Zinc finger
IPR007087 549 576 PS50157 Zinc finger
IPR007087 577 604 PS50157 Zinc finger
IPR007087 605 632 PS50157 Zinc finger
IPR007087 633 660 PS50157 Zinc finger
ScanRegExp IPR007087 411 431 PS00028 Zinc finger
IPR007087 439 459 PS00028 Zinc finger
IPR007087 495 515 PS00028 Zinc finger
IPR007087 523 543 PS00028 Zinc finger
IPR007087 551 571 PS00028 Zinc finger
IPR007087 579 599 PS00028 Zinc finger
IPR007087 605 627 PS00028 Zinc finger
IPR007087 635 655 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp