ORK00327

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00327

Order Kazusa clone(s) from :

Accession No	AB208795
Product ID	ORK00327
Clone name	fh23011
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KDM6A
cDNA sequence	DNA sequence (5372 bp) Predicted protein sequence (1406 aa)
HaloTag ORF Clone	FHC00327
Flexi ORF Clone	FXC00327
Description	Ubiquitously transcribed X chromosome tetratricopeptide repeat protein (Ubiquitously transcribed TPR protein on the X chromosome).

Features of the cloned cDNA sequence

Description

Length: 5372 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	836 bp
Genome contig ID	gi89161218f_44517415
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGTACAGAAACTTTTATTAAAATTGTTTAATGTTT
Flanking genome sequence (339023 - 339072)	----+--------+--------+--------+--------+----* AAAGAGTTTTCTATTGTTTGAGTTTTAAAAAAGACTTTATGTACAGTGCC

Features of the protein sequence

Description

Length: 1406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92032	100.0	ubiquitously tr...	Homo sapiens
CAI40508	100.0	ubiquitously tr...	Homo sapiens
AAH93868	99.9	Ubiquitously tr...	Homo sapiens
O15550	99.7	Lysine-specific...	Homo sapiens
XP_850658	99.0	similar to ubiq...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	98	131	PF00515	Tetratricopeptide TPR_1
	IPR001440	135	168	PF00515	Tetratricopeptide TPR_1
	IPR001440	210	243	PF00515	Tetratricopeptide TPR_1
	IPR001440	274	288	PF00515	Tetratricopeptide TPR_1
	IPR001440	289	322	PF00515	Tetratricopeptide TPR_1
	IPR001440	323	356	PF00515	Tetratricopeptide TPR_1
	IPR001440	357	390	PF00515	Tetratricopeptide TPR_1
	IPR013129	1138	1246	PF02373	Transcription factor jumonji
HMMSmart	IPR013026	98	131	SM00028	Tetratricopeptide region
	IPR013026	135	168	SM00028	Tetratricopeptide region
	IPR013026	210	243	SM00028	Tetratricopeptide region
	IPR013026	289	322	SM00028	Tetratricopeptide region
	IPR013026	323	356	SM00028	Tetratricopeptide region
	IPR013026	357	390	SM00028	Tetratricopeptide region
	IPR003347	1100	1263	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR013026	98	131	PS50005	Tetratricopeptide region
	IPR013026	98	390	PS50293	Tetratricopeptide region
	IPR013026	135	168	PS50005	Tetratricopeptide region
	IPR013026	210	243	PS50005	Tetratricopeptide region
	IPR013026	255	288	PS50005	Tetratricopeptide region
	IPR013026	289	322	PS50005	Tetratricopeptide region
	IPR013026	323	356	PS50005	Tetratricopeptide region
	IPR013026	357	390	PS50005	Tetratricopeptide region
	IPR003347	1100	1263	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp