Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00329
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00329
Clone name ha04833
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol WHSC1L1
cDNA sequence DNA sequence (4819 bp)
Predicted protein sequence (1443 aa)
Flexi ORF Clone FXC00329
Description Histone-lysine N-methyltransferase NSD3 (EC 2.1.1.43) (Nuclear SET domain-containing protein 3) (WHSC1-like protein 1) (Wolf-Hirschhorn syndrome candidate 1-like protein 1) (Whistle) (WHSC1-like 1 isoform 9 with methyltransferase activity to lysine).
Features of the cloned cDNA sequence

Length: 4819 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 32 bp
Genome contig ID gi51511724r_38152284
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAAATGTGTGGTGTCCCCTCCTTTCTATTTAAGTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAGCAAATAGATCATGCATTTAAAAAGAAGAGACTGCTACAGTGCA

Features of the protein sequence

Length: 1443 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BZ95 0 100.0 Histone-lysine ...
 Homo sapiens
CAC28350 0 99.9 putative chroma...
 Homo sapiens
XP_519713 0 99.6 WHSC1L1 protein...
 Pan troglodytes
AAI15007 0 99.6 Wolf-Hirschhorn...
 Homo sapiens
XP_001091186 0 97.3 similar to WHSC...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000313 273 352 PF00855 PWWP
IPR001965 709 754 PF00628 Zinc finger
IPR001965 921 961 PF00628 Zinc finger
IPR000313 963 1039 PF00855 PWWP
IPR001214 1145 1274 PF00856 SET
IPR001965 1329 1379 PF00628 Zinc finger
HMMSmart IPR000313 274 337 SM00293 PWWP
IPR001965 709 752 SM00249 Zinc finger
IPR001965 757 804 SM00249 Zinc finger
IPR001965 805 857 SM00249 Zinc finger
IPR001965 922 959 SM00249 Zinc finger
IPR000313 964 1026 SM00293 PWWP
IPR006560 1099 1150 SM00570 AWS
IPR001214 1151 1274 SM00317 SET
IPR003616 1275 1291 SM00508 Post-SET zinc-binding region
IPR001965 1329 1372 SM00249 Zinc finger
ProfileScan IPR000313 276 339 PS50812 PWWP
IPR001965 707 754 PS50016 Zinc finger
IPR000313 966 1028 PS50812 PWWP
IPR006560 1099 1149 PS51215 AWS
IPR001214 1150 1272 PS50280 SET
IPR003616 1275 1291 PS50868 Post-SET zinc-binding region
IPR001965 1327 1374 PS50016 Zinc finger
ScanRegExp IPR001965 710 751 PS01359 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp