ORK00334

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00334

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00334
Clone name	pf02435
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DRP2
cDNA sequence	DNA sequence (7069 bp) Predicted protein sequence (961 aa)
HaloTag ORF Clone	FHC00334
Flexi ORF Clone	FXC00334
Description	Dystrophin-related protein 2.

Features of the cloned cDNA sequence

Description

Length: 7069 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3876 bp
Genome contig ID	gi89161218f_100261639
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTCTGCTTTGAAAAGAATAAATTTGTACTTGTTT
Flanking genome sequence (144504 - 144553)	----+--------+--------+--------+--------+----* ACTTTGGTTCCTCTGGTTATACTCTCTGAGTCTGATATTTCATATCTTTC

Features of the protein sequence

Description

Length: 961 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX02844	100.0	dystrophin rela...	Homo sapiens
AAI11696	100.0	Dystrophin rela...	Homo sapiens
XP_001092374	99.4	dystrophin rela...	Macaca mulatta
Q13474	99.6	Dystrophin-rela...	Homo sapiens
BAF82514	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	235	341	PF00435	Spectrin repeat
	IPR001202	358	387	PF00397	WW/Rsp5/WWP
	IPR015153	388	508	PF09068	EF-hand
	IPR015154	512	603	PF09069	EF-hand
	IPR000433	608	653	PF00569	Zinc finger
HMMSmart	IPR002017	109	231	SM00150	Spectrin repeat
	IPR002017	238	340	SM00150	Spectrin repeat
	IPR001202	357	389	SM00456	WW/Rsp5/WWP
	IPR000433	608	653	SM00291	Zinc finger
ProfileScan	IPR001202	356	389	PS50020	WW/Rsp5/WWP
ProfileScan	IPR000433	608	655	PS50135	Zinc finger
ScanRegExp	IPR001202	362	387	PS01159	WW/Rsp5/WWP
ScanRegExp	IPR000433	614	641	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp