ORK00337

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00337

Order Kazusa clone(s) from :

Accession No	AB209477
Product ID	ORK00337
Clone name	ah05676
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ALK
cDNA sequence	DNA sequence (5803 bp) Predicted protein sequence (1626 aa)
HaloTag ORF Clone	FHC00337
Flexi ORF Clone	FXC00337
Description	Homo sapiens mRNA for anaplastic lymphoma kinase Ki-1 variant protein

Features of the cloned cDNA sequence

Description

Length: 5803 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	451 bp
Genome contig ID	gi89161199r_29169147
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GAGGGAACGGAAATAAAGGAGTTATTTGTAATGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TAAGCATGGGGAAAGACATTCTTTACTTGAAAAAGAAAAAATCATAGACA

Features of the protein sequence

Description

Length: 1626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92714	100.0	anaplastic lymp...	Homo sapiens
AAC51104	100.0	anaplastic lymp...	Homo sapiens
Q9UM73	99.8	ALK tyrosine ki...	Homo sapiens
AAI56208	99.8	Anaplastic lymp...	synthetic construct
ACI47598	99.7	anaplastic lymp...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1128	1382	PD000001	Protein kinase
FPrintScan	IPR001245	1202	1215	PR00109	Tyrosine protein kinase
	IPR001245	1245	1263	PR00109	Tyrosine protein kinase
	IPR001245	1297	1307	PR00109	Tyrosine protein kinase
	IPR001245	1316	1338	PR00109	Tyrosine protein kinase
	IPR001245	1360	1382	PR00109	Tyrosine protein kinase
HMMPfam	IPR000998	486	642	PF00629	MAM
HMMPfam	IPR001245	1122	1389	PF07714	Tyrosine protein kinase
HMMSmart	IPR002172	443	479	SM00192	Low density lipoprotein-receptor
	IPR001245	1122	1389	SM00219	Tyrosine protein kinase
	IPR002290	1122	1392	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000998	270	433	PS50060	MAM
	IPR000998	484	642	PS50060	MAM
	IPR000719	1122	1398	PS50011	Protein kinase
ScanRegExp	IPR000719	1128	1156	PS00107	Protein kinase
	IPR008266	1251	1263	PS00109	Tyrosine protein kinase
	IPR002011	1282	1290	PS00239	Receptor tyrosine kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	MGAIGLLWLLPLLLSTAAVGSGM	29	PRIMARY	23
SOSUI2	2	1044	SVVTSALVAALVLAFSGIMIVY	1065	PRIMARY	22