Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00339
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00339
Clone name bm04873
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CREB1
cDNA sequence DNA sequence (2589 bp)
Predicted protein sequence (341 aa)
Flexi ORF Clone FXC00339
Description cAMP response element-binding protein (CREB).
Features of the cloned cDNA sequence

Length: 2589 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1428 bp
Genome contig ID gi89161199f_208002977
PolyA signal sequence
(GATAAA,-22)		 
+----*----+----*----+----*----+----
ATTCACTAAGCTCGATAAATCTAACAGTTACTCTT
Flanking genome sequence
(168480 - 168529)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGACTAAGGTGGATTTTAAAAATTGGAAACTGACA

Features of the protein sequence

Length: 341 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P16220 8.7e-114 100.0 Cyclic AMP-resp...
 Homo sapiens
Q01147 1.5e-113 99.7 Cyclic AMP-resp...
 Mus musculus
CAH90342 1.7e-113 99.7 hypothetical pr...
 Pongo abelii
XP_001505170 2.5e-113 99.7 similar to cAMP...
 Equus caballus
P15337 5.5e-113 99.1 Cyclic AMP-resp...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001630 118 140 PR00041 cAMP response element binding (CREB) protein
IPR001630 167 182 PR00041 cAMP response element binding (CREB) protein
IPR001630 244 255 PR00041 cAMP response element binding (CREB) protein
IPR001630 280 296 PR00041 cAMP response element binding (CREB) protein
IPR001630 298 318 PR00041 cAMP response element binding (CREB) protein
IPR001630 318 335 PR00041 cAMP response element binding (CREB) protein
HMMPfam IPR003102 113 153 PF02173 Coactivator CBP
IPR011616 281 341 PF00170 bZIP transcription factor
HMMSmart IPR004827 281 339 SM00338 Basic-leucine zipper (bZIP) transcription factor
ProfileScan IPR003102 101 160 PS50953 Coactivator CBP
IPR004827 283 334 PS50217 Basic-leucine zipper (bZIP) transcription factor
ScanRegExp IPR004827 289 303 PS00036 Basic-leucine zipper (bZIP) transcription factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp