Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00341
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00341
Clone name ef00973
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LAMC1
cDNA sequence DNA sequence (7858 bp)
Predicted protein sequence (1684 aa)
Flexi ORF Clone FXC00341
Description Laminin subunit gamma-1 precursor (Laminin B2 chain).
Features of the cloned cDNA sequence

Length: 7858 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2802 bp
Genome contig ID gi89161185f_181159249
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TATTTATAATAAAATCTGAATATTTGTAACCCTTT
Flanking genome sequence
(222102 - 222151)
----+----*----+----*----+----*----+----*----+----*
ATATTTGGTGTGGCCTGAGTGTGGTACTGGGGACATAAGATGTTTTAAAA

Features of the protein sequence

Length: 1684 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAA59488 0 100.0 laminin B2 prec...
Homo sapiens
P11047 0 99.9 Laminin subunit...
Homo sapiens
CAH70981 0 99.8 laminin, gamma ...
Homo sapiens
XP_001162648 0 99.4 laminin, gamma ...
Pan troglodytes
EAW91144 0 99.8 laminin, gamma ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000034 552 679 PD003031 Laminin B
FPrintScan IPR002049 973 991 PR00011 EGF-like
IPR002049 1022 1040 PR00011 EGF-like
IPR002049 1041 1069 PR00011 EGF-like
IPR002049 1069 1087 PR00011 EGF-like
HMMPfam IPR008211 125 359 PF00055 Laminin
IPR002049 361 414 PF00053 EGF-like
IPR002049 417 470 PF00053 EGF-like
IPR002049 473 517 PF00053 EGF-like
IPR002049 520 567 PF00053 EGF-like
IPR000034 633 763 PF00052 Laminin B
IPR002049 799 845 PF00053 EGF-like
IPR002049 848 900 PF00053 EGF-like
IPR002049 903 956 PF00053 EGF-like
IPR002049 959 1007 PF00053 EGF-like
IPR002049 1010 1055 PF00053 EGF-like
IPR002049 1058 1103 PF00053 EGF-like
HMMSmart IPR008211 119 359 SM00136 Laminin
IPR002049 361 414 SM00180 EGF-like
IPR006210 413 455 SM00181 EGF
IPR002049 417 470 SM00180 EGF-like
IPR002049 473 517 SM00180 EGF-like
IPR006210 474 518 SM00181 EGF
IPR006210 519 568 SM00181 EGF
IPR002049 520 567 SM00180 EGF-like
IPR000034 628 753 SM00281 Laminin B
IPR006210 795 827 SM00181 EGF
IPR002049 799 845 SM00180 EGF-like
IPR006210 844 880 SM00181 EGF
IPR002049 848 900 SM00180 EGF-like
IPR002049 903 956 SM00180 EGF-like
IPR006210 916 957 SM00181 EGF
IPR002049 959 1007 SM00180 EGF-like
IPR006210 1006 1041 SM00181 EGF
IPR002049 1010 1055 SM00180 EGF-like
IPR006210 1042 1088 SM00181 EGF
IPR002049 1058 1103 SM00180 EGF-like
ProfileScan IPR008211 121 360 PS51117 Laminin
IPR002049 361 416 PS50027 EGF-like
IPR002049 417 472 PS50027 EGF-like
IPR002049 473 519 PS50027 EGF-like
IPR002049 520 569 PS50027 EGF-like
IPR000034 596 764 PS51115 Laminin B
IPR002049 799 847 PS50027 EGF-like
IPR002049 848 902 PS50027 EGF-like
IPR002049 903 958 PS50027 EGF-like
IPR002049 959 1009 PS50027 EGF-like
IPR002049 1010 1057 PS50027 EGF-like
IPR002049 1058 1105 PS50027 EGF-like
ScanRegExp IPR013032 380 391 PS00022 EGF-like region
IPR002049 380 414 PS01248 EGF-like
IPR002049 442 475 PS01248 EGF-like
IPR013032 491 502 PS00022 EGF-like region
IPR002049 491 522 PS01248 EGF-like
IPR013032 538 549 PS00022 EGF-like region
IPR002049 538 572 PS01248 EGF-like
IPR013032 765 776 PS00022 EGF-like region
IPR013032 765 779 PS01186 EGF-like region
IPR002049 765 799 PS01248 EGF-like
IPR013032 815 826 PS00022 EGF-like region
IPR002049 815 850 PS01248 EGF-like
IPR002049 867 903 PS01248 EGF-like
IPR002049 924 959 PS01248 EGF-like
IPR013032 980 991 PS00022 EGF-like region
IPR002049 980 1012 PS01248 EGF-like
IPR013032 1029 1040 PS00022 EGF-like region
IPR002049 1029 1060 PS01248 EGF-like
IPR013032 1076 1087 PS00022 EGF-like region
IPR013032 1076 1090 PS01186 EGF-like region
IPR002049 1076 1109 PS01248 EGF-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp