ORK00348

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00348

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00348
Clone name	hg04246
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF638
cDNA sequence	DNA sequence (6460 bp) Predicted protein sequence (2050 aa)
HaloTag ORF Clone	FHC00348
Flexi ORF Clone	FXC00348
Description	Zinc finger protein 638 (Nuclear protein 220) (Zinc-finger matrin-like protein) (Cutaneous T-cell lymphoma-associated antigen se33-1) (CTCL tumor antigen se33-1).

Features of the cloned cDNA sequence

Description

Length: 6460 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	250 bp
Genome contig ID	gi89161199f_71312443
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGTTAAAATAAATGTTCCTACTGTATATTTAAAAT
Flanking genome sequence (203254 - 203303)	----+--------+--------+--------+--------+----* ACCATCTGTGTTTGTGGCTGATTTTTTAAAGACTTGCTTGCCTCTGATTG

Features of the protein sequence

Description

Length: 2050 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14966	100.0	Zinc finger pro...	Homo sapiens
CAH18177	99.7	hypothetical pr...	Homo sapiens
BAA11748	99.8	nuclear protein...	Homo sapiens
CAD97667	99.7	hypothetical pr...	Homo sapiens
XP_001149094	98.8	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	750	811	PF00076	RNA recognition motif
HMMSmart	IPR003604	495	529	SM00451	Zinc finger
	IPR015880	498	522	SM00355	Zinc finger
	IPR000504	749	819	SM00360	RNA recognition motif
	IPR000504	978	1047	SM00360	RNA recognition motif
	IPR003604	1997	2031	SM00451	Zinc finger
	IPR015880	2000	2024	SM00355	Zinc finger
ProfileScan	IPR000504	748	818	PS50102	RNA recognition motif
ProfileScan	IPR000690	2000	2030	PS50171	Zinc finger
ScanRegExp	IPR007087	500	522	PS00028	Zinc finger
ScanRegExp	IPR007087	2002	2024	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp