ORK00349

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00349

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00349
Clone name	ef03333
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	VWF
cDNA sequence	DNA sequence (8775 bp) Predicted protein sequence (2839 aa)
HaloTag ORF Clone	FHC00349
Flexi ORF Clone	FXC00349
Description	von Willebrand factor precursor (vWF) [Contains: von Willebrand antigen 2 (von Willebrand antigen II)].

Features of the cloned cDNA sequence

Description

Length: 8775 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	134 bp
Genome contig ID	gi89161190r_5828308
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTGAGCCCACAATAAAGGCTGAGCTCTTATCTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGGCTGCTGGTGCACTGTGTCGTAGGGCTGAGATGGCAACGGTGGGC

Features of the protein sequence

Description

Length: 2839 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11022	100.0	von Willebrand ...	synthetic construct
P04275	99.9	von Willebrand ...	Homo sapiens
CAA27972	99.9	unnamed protein...	Homo sapiens
EAW88814	99.9	von Willebrand ...	Homo sapiens
NP_000543	99.8	von Willebrand ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	1302	1319	PR00453	von Willebrand factor
	IPR002035	1562	1576	PR00453	von Willebrand factor
	IPR002035	1822	1830	PR00453	von Willebrand factor
HMMPfam	IPR001846	61	205	PF00094	von Willebrand factor
	IPR014853	244	318	PF08742	Domain of unknown function DUF1787
	IPR002919	321	374	PF01826	Protease inhibitor I8
	IPR001846	414	567	PF00094	von Willebrand factor
	IPR014853	603	675	PF08742	Domain of unknown function DUF1787
	IPR002919	678	733	PF01826	Protease inhibitor I8
	IPR001846	893	1039	PF00094	von Willebrand factor
	IPR014853	1079	1153	PF08742	Domain of unknown function DUF1787
	IPR002919	1172	1222	PF01826	Protease inhibitor I8
	IPR002035	1303	1483	PF00092	von Willebrand factor
	IPR002035	1524	1690	PF00092	von Willebrand factor
	IPR002035	1717	1890	PF00092	von Willebrand factor
	IPR001846	1976	2128	PF00094	von Willebrand factor
	IPR014853	2158	2226	PF08742	Domain of unknown function DUF1787
	IPR001007	2283	2351	PF00093	von Willebrand factor
	IPR001007	2457	2520	PF00093	von Willebrand factor
	IPR001007	2608	2670	PF00093	von Willebrand factor
HMMSmart	IPR001846	45	204	SM00216	von Willebrand factor
	IPR006552	376	444	SM00215	VWC out
	IPR001007	376	436	SM00214	von Willebrand factor
	IPR001846	403	566	SM00216	von Willebrand factor
	IPR001007	855	897	SM00214	von Willebrand factor
	IPR006552	855	924	SM00215	VWC out
	IPR001846	882	1038	SM00216	von Willebrand factor
	IPR002035	1301	1484	SM00327	von Willebrand factor
	IPR002035	1522	1695	SM00327	von Willebrand factor
	IPR002035	1715	1889	SM00327	von Willebrand factor
	IPR001846	1964	2127	SM00216	von Willebrand factor
	IPR001007	2283	2351	SM00214	von Willebrand factor
	IPR001007	2457	2520	SM00214	von Willebrand factor
	IPR001007	2608	2670	SM00214	von Willebrand factor
	IPR006207	2753	2838	SM00041	Cystine knot
ProfileScan	IPR001846	60	266	PS51233	von Willebrand factor
	IPR001846	413	624	PS51233	von Willebrand factor
	IPR001846	892	1100	PS51233	von Willebrand factor
	IPR002035	1303	1479	PS50234	von Willebrand factor
	IPR002035	1524	1691	PS50234	von Willebrand factor
	IPR002035	1717	1897	PS50234	von Willebrand factor
	IPR001846	1975	2179	PS51233	von Willebrand factor
	IPR001007	2281	2354	PS50184	von Willebrand factor
	IPR001007	2455	2521	PS50184	von Willebrand factor
	IPR001007	2606	2671	PS50184	von Willebrand factor
	IPR006207	2750	2838	PS01225	Cystine knot
ScanRegExp	IPR001007	2304	2351	PS01208	von Willebrand factor
	IPR001007	2474	2520	PS01208	von Willebrand factor
	IPR001007	2626	2670	PS01208	von Willebrand factor
	IPR006207	2799	2837	PS01185	Cystine knot

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	29	PARFAGVLLALALILPGTLCAE	50	PRIMARY	22
SOSUI2	2	72	FDGSMYSFAGYCSYLLAGGCQK	93	SECONDARY	22