ORK00361

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00361

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00361
Clone name	af25953
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BAG3
cDNA sequence	DNA sequence (2478 bp) Predicted protein sequence (647 aa)
HaloTag ORF Clone	FHC00361
Flexi ORF Clone	FXC00361
Description	BAG family molecular chaperone regulator 3 (BCL-2-binding athanogene- 3) (BAG-3) (Bcl-2-binding protein Bis) (Docking protein CAIR-1).

Features of the cloned cDNA sequence

Description

Length: 2478 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	533 bp
Genome contig ID	gi89161187f_121300961
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTAAAAAAAGAAAATAAAGTAATAATATAACTC
Flanking genome sequence (126358 - 126407)	----+--------+--------+--------+--------+----* AAAATGGTTTTTGTGGTTTCTAAATCTTTGAAAGCAGTGGCATCATGGAG

Features of the protein sequence

Description

Length: 647 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_508072	1.9e-167	98.9	hypothetical pr...	Pan troglodytes
XP_001104160	5.3e-163	96.1	BCL2-associated...	Macaca mulatta
T46292	2.4e-160	99.8	9555 Lambda-PRL...	Arabidopsis tha...
O95817	3.5e-149	100.0	BAG family mole...	Homo sapiens
AAD16122	9.5e-149	99.6	BAG-family mole...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	94	124	PF00397	WW/Rsp5/WWP
HMMPfam	IPR003103	493	570	PF02179	Apoptosis regulator Bcl-2 protein
HMMSmart	IPR001202	93	126	SM00456	WW/Rsp5/WWP
HMMSmart	IPR003103	493	570	SM00264	Apoptosis regulator Bcl-2 protein
ProfileScan	IPR001202	92	126	PS50020	WW/Rsp5/WWP
ProfileScan	IPR003103	493	570	PS51035	Apoptosis regulator Bcl-2 protein
ScanRegExp	IPR001202	98	124	PS01159	WW/Rsp5/WWP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp