ORK00852

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00852

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00852
Clone name	hg00622s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGCCCACGCG TCCG-5' end of cDNA. This cDNA clone hg00622s2 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	EP400
cDNA sequence	DNA sequence (11930 bp) Predicted protein sequence (3044 aa)
HaloTag ORF Clone	FHC00852
Flexi ORF Clone	FXC00852
Description	E1A binding protein p400

Features of the cloned cDNA sequence

Description

Length: 11930 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2793 bp
Genome contig ID	gi89161190f_130911113
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAGGCAAAATAAAGTGACCTTTTTATATATTTTTT
Flanking genome sequence (219853 - 219902)	----+--------+--------+--------+--------+----* CATTTTGTCTTTCATAGAAAACTGGTATTTAAGTTAAATGAGATGCTGAA

Features of the protein sequence

Description

Length: 3044 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10081	100.0	E1A binding pro...	synthetic construct
EDM14033	86.2	E1A binding pro...	Rattus norvegicus
BAC45253	85.8	mDomino [Mus mu...	Mus musculus
EDL20007	85.8	E1A binding pro...	Mus musculus
NP_083613	85.8	E1A-binding pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006562	765	836	PF07529	HSA
	IPR000330	1059	1339	PF00176	SNF2-related
	IPR001650	1817	1884	PF00271	DNA/RNA helicase
HMMSmart	IPR013999	765	836	SM00573	HAS subgroup
	IPR014001	1052	1241	SM00487	DEAD-like helicases
	IPR001650	1812	1898	SM00490	DNA/RNA helicase
ProfileScan	IPR014012	764	836	PS51204	Helicase/SANT-associated
	IPR014021	1068	1233	PS51192	Helicase
	IPR001650	1783	1940	PS51194	DNA/RNA helicase
	IPR001005	2244	2313	PS50090	SANT

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp