ORK00916

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00916

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00916
Clone name	fg01285y2
Vector information	The cDNA fragment was inserted at SalI-NotI site of the The cDNA fragment was inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGAATTCGAT T-5' end of cDNA
Symbol	KIAA1783
cDNA sequence	DNA sequence (9652 bp) Predicted protein sequence (3096 aa)
HaloTag ORF Clone	FHC00916
Flexi ORF Clone	FXC00916
Description	CDNA: FLJ22686 fis, clone HSI10987.

Features of the cloned cDNA sequence

Description

Length: 9652 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	361 bp
Genome contig ID	gi51511734f_70995734
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AGAAACAGCTGCTGAGGAAATAAAACTCCCTGGAG
Flanking genome sequence (138788 - 138837)	----+--------+--------+--------+--------+----* AAAAGGGCTGTGTGCACGCCTGCATGCCCCACAACAACACAACTTTATTC

Features of the protein sequence

Description

Length: 3096 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JP2	98.3	Putative myosin...	Homo sapiens
EAW89288	98.2	hCG1987119, iso...	Homo sapiens
XP_540435	66.2	similar to Myos...	Canis lupus fam...
XP_001095714	90.4	similar to Myos...	Macaca mulatta
EAW89286	97.1	hCG1987119, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001609	750	769	PR00193	Myosin head
	IPR001609	811	836	PR00193	Myosin head
	IPR001609	855	882	PR00193	Myosin head
	IPR001609	1089	1117	PR00193	Myosin head
HMMPfam	IPR001609	722	1382	PF00063	Myosin head
	IPR000048	1415	1435	PF00612	IQ calmodulin-binding region
	IPR000857	1590	1702	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR011511	2485	2540	PF07653	Variant SH3
	IPR000857	2683	2789	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001609	714	1395	SM00242	Myosin head
	IPR000857	1551	1702	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR001452	2484	2541	SM00326	Src homology-3
	IPR000857	2643	2789	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	2791	2993	SM00295	Band 4.1
ProfileScan	IPR000048	1414	1443	PS50096	IQ calmodulin-binding region
	IPR000857	1551	1702	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR001452	2481	2542	PS50002	Src homology-3
	IPR000857	2643	2789	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	2795	3096	PS50057	Band 4.1
ScanRegExp	IPR000194	613	622	PS00152	ATPase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	974	ELNAVWAVLAAILQLGNICFSSS	996	PRIMARY	23